MRPS24 cDNA ORF Clone, Human, N-OFPSpark® tag

Price:
Size:
Number:

MRPS24 cDNA ORF Clone, Human, N-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein S24 with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MRPS24 cDNA ORF Clone, Human, N-OFPSpark® tag: Synonyms

bMRP-47 cDNA ORF Clone, Human; bMRP47 cDNA ORF Clone, Human; HSPC335 cDNA ORF Clone, Human; MRP-S24 cDNA ORF Clone, Human; S24mt cDNA ORF Clone, Human

MRPS24 Background Information

MRPS24 (Mitochondrial Ribosomal Protein S24) is a Protein Coding gene. The MRPS24 gene, located on 7p13, is conserved in chimpanzee, Rhesus monkey, cow, mouse, rat, zebrafish, fruit fly, mosquito, C.elegans, and frog. MRPS24 belongs to the universal ribosomal protein uS3 family. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 11. Read-through transcription exists between this gene and the upstream upregulation of cell proliferation (URGCP) gene. MRPS24 is widely expressed in the kidney, adrenal, and other tissues. Among its related pathways are Organelle biogenesis and maintenance and Mitochondrial translation. 195 organisms have orthologs with the human gene MRPS24.
Full Name
mitochondrial ribosomal protein S24
References
  • Xu L, et al. (1994) Molecular characterization of the mouse ribosomal protein s24 multigene family: A uniquely expressed intron-containing gene with cell-specific expression of three alternatively spliced mrnas. Nucleic Acids Res 22 (4): 646-655.
  • Mao M, et al. (1998) Identification of genes expressed in human cd34(+) hematopoietic stem/progenitor cells by expressed sequence tags and efficient full-length cdna cloning. Proc Natl Acad Sci U S A 95 (14): 8175-8180.
  • Koc EC, et al. (2000) A proteomics approach to the identification of mammalian mitochondrial small subunit ribosomal proteins. J Biol Chem 275 (42): 32585-32591.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.