MAPKAP1 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

MAPKAP1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase associated protein 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.51kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MAPKAP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAPKAP1 cDNA ORF Clone, Human, C-His tag: Validated Images

MAPKAP1 cDNA ORF Clone, Human, C-His tag: Synonyms

JC310 cDNA ORF Clone, Human; MIP1 cDNA ORF Clone, Human; SIN1 cDNA ORF Clone, Human; SIN1b cDNA ORF Clone, Human; SIN1g cDNA ORF Clone, Human

MAPKAP1 Background Information

Full Name
mitogen-activated protein kinase associated protein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.