Lyn cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Lyn cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Lyn cDNA ORF Clone, Human, untagged: Synonyms

JTK8 cDNA ORF Clone, Human; p53Lyn cDNA ORF Clone, Human; p56Lyn cDNA ORF Clone, Human

Lyn Background Information

Tyrosine-protein kinase Lyn is a member of the Src family of protein tyrosine kinases, which is mainly expressed in hematopoietic cells, in neural tissues liver, and adipose tissue. Tyrosine-protein kinase Lyn has many functions. Lyn kinase may down regulate expression of stem cell growth factor receptor (KIT). Lyn kinase Acts as an effector of EpoR (erythropoietin receptor) in controlling KIT expression and may play a central role in erythroid differentiation during the switch between proliferation and maturation. Lyn kinase also acts as a positive regulator of cell movement while negatively regulating adhesion to stromal cells by inhibiting the ICAM-1-binding activity of beta-2 integrins. Lyn kinase relays suppressing signals from the chemokine receptor CXCR4 to beta-2 integrin LFA-1 in hematopoietic precursors. This kinase is Involved in induction of stress-activated protein kinase (SAPK), but not ERK or p38 MAPK, in response to genotoxic agents. In a word, Lyn kinase functions primarily as negative regulator, but can also function as activator, depending on the context. Tyrosine-protein kinase Lyn Required for the initiation of the B-cell response, but also for its down-regulation and termination. It also Plays an important role in the regulation of B-cell differentiation, proliferation, survival and apoptosis, and is important for immune self-tolerance. It has been reported that Lyn kinase plays a role in the inflammatory response to bacterial lipopolysaccharide. Lyn kinase Mediates the responses to cytokines and growth factors in hematopoietic progenitors, platelets, erythrocytes, and in mature myeloid cells, such as dendritic cells, neutrophils and eosinophils.
Full Name
LYN proto-oncogene, Src family tyrosine kinase
Related Pathways
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
References
  • Grishin A V, et al. (2001) Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis. Proc Natl Acad Sci U.S.A. 98 (18): 10172-7.
  • Hayashi T, et al. (1999) The AMPA receptor interacts with and signals through the protein tyrosine kinase Lyn. Nature. 397(6714): 72-6.
  • Ptasznik A, et al. (2004) Short interfering RNA (siRNA) targeting the Lyn kinase induces apoptosis in primary, and drug-resistant, BCR-ABL1(+) leukemia cells. Nat Med. 10(11): 1187-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.