LTBR cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

LTBR cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1350 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 516 A/C not causing the amino acid variation.
Description
Full length Clone DNA of Human lymphotoxin beta receptor (TNFR superfamily, member 3) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+1.35kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LTBR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LTBR cDNA ORF Clone, Human, C-HA tag: Validated Images

LTBR cDNA ORF Clone, Human, C-HA tag: Synonyms

CD18 cDNA ORF Clone, Human; D12S370 cDNA ORF Clone, Human; LT-BETA-R cDNA ORF Clone, Human; TNF-R-III cDNA ORF Clone, Human; TNFCR cDNA ORF Clone, Human; TNFR-RP cDNA ORF Clone, Human; TNFR2-RP cDNA ORF Clone, Human; TNFR3 cDNA ORF Clone, Human; TNFRSF3 cDNA ORF Clone, Human

LTBR Background Information

LTBR (lymphotoxin beta receptor (TNFR superfamily, member 3)) is a member of the tumor necrosis factor (TNF) family of receptors. The tumor necrosis factor receptor is a trimeric cytokine receptor that binds tumor necrosis factors. The receptor cooperates with an adaptor protein (such as TRADD, TRAF, RIP), which is important in determining the outcome of the response. LTBR is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LTBR specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphotoxin-beta). LTBR and its ligand play a role in the development and organization of lymphoid tissue and transformed cells. Activation of this protein can trigger apoptosis. Not only does the LTBR help trigger apoptosis, but it can also lead to the release of the cytokine interleukin 8. Overexpression of LTBR in HEK293 cells increases IL-8 promoter activity and leads to IL-8 release. It is also essential for the development and organization of the secondary lymphoid organs and chemokine release.
Full Name
lymphotoxin beta receptor (TNFR superfamily, member 3)
References
  • Summers deLuca L, et al. (2011) A LTβR signaling in dendritic cells induces a type I IFN response that is required for optimal clonal expansion of CD8+ T cells. Proc Natl Acad Sci. 108(5):2046-51.
  • Bista P, et al. (2010) TRAF3 controls activation of the canonical and alternative NFkappaB by the lymphotoxin beta receptor. J Biol Chem. 285(17):12971-8.
  • Xu Y, et al. (2011) Adiponectin inhibits lymphotoxin-β receptor-mediated NF-κB signaling in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 404(4):1060-4.
  • HMGB1/TNFR1/NF-κB Axis in Prostate cancer: Clinical and Biological Correlation
    Author
    Jung, AR;Kim, GE;Kim, MY;Ha, US;Hong, SH;Lee, JY;
    Year
    2020
    Journal
    Research Square
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.