KRAS cDNA ORF Clone, Human, N-GFPSpark® tag

1/1
Price:
Size:
Number:

KRAS cDNA ORF Clone, Human, N-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
507 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-Ki-ras2 Kirsten rat sarcoma viral oncogene homol with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6kb + 1.3kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KRAS cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KRAS cDNA ORF Clone, Human, N-GFPSpark® tag: Validated Images

KRAS cDNA ORF Clone, Human, N-GFPSpark® tag: Synonyms

C-K-RAS cDNA ORF Clone, Human; CFC2 cDNA ORF Clone, Human; K-RAS cDNA ORF Clone, Human; K-RAS2A cDNA ORF Clone, Human; K-RAS2B cDNA ORF Clone, Human; K-RAS4A cDNA ORF Clone, Human; K-RAS4B cDNA ORF Clone, Human; KI-RAS cDNA ORF Clone, Human; KRAS1 cDNA ORF Clone, Human; KRAS2 cDNA ORF Clone, Human; NS cDNA ORF Clone, Human; NS3 cDNA ORF Clone, Human; RALD cDNA ORF Clone, Human; RASK2 cDNA ORF Clone, Human

KRAS Background Information

K-Ras belongs to the small GTPase superfamily, Ras family. Like other members of the Ras family, K-Ras is a GTPase and is an early player in many signal transduction pathways. It is usually tethered to cell membranes because of the presence of an isoprenyl group on its C-terminus. K-Ras functions as a molecular on/off switch. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raf and PI 3-kinase. It binds to GTP in the active state and possesses an intrinsic enzymatic activity that cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP, K-Ras is turned off. The rate of conversion is usually slow but can be sped up dramatically by an accessory protein of the GTPase activating protein class, for example, RasGAP. In turn, K-Ras can bind to proteins of the Guanine Nucleotide Exchange Factor class, for example, SOS1, which forces the release of bound nucleotide. Subsequently, K-Ras binds GTP present in the cytosol and the GEF is released from ras-GTP. Besides essential function in normal tissue signaling, the mutation of a K-Ras gene is an essential step in the development of many cancers. Several germline K-Ras mutations are associated with Noonan syndrome and Cardio-Facio-Cutaneous syndrome. Somatic K-Ras mutations are found at high rates in Leukemias, colon cancer, pancreatic cancer, and lung cancer.
Full Name
Kirsten rat sarcoma viral oncogene homolog
Research Areas
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • TGF-beta Signaling
    TGF-beta Signaling
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Common G-Chain signaling pathway
    Common G-Chain signaling pathway
References
  • Ling J, et al. (2012) KrasG12D-induced IKK2//NF-B activation by IL-1 alpha and p62 feedforward loops is required for development of pancreatic ductal adenocarcinoma. Cancer Cell. 21(1):105-20.
  • Matallanas D, et al. (2011) Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell. 44(6):893-906.
  • Regala RP, et al. (2011) Matrix metalloproteinase-10 promotes Kras-mediated bronchio-alveolar stem cell expansion and lung cancer formation. PLoS One. 6(10):e26439.
  • EPHA2 feedback activation limits the response to PDEδ inhibition in KRAS-dependent cancer cells
    Author
    Chen, YH;Lv, H;Shen, N;Wang, XM;Tang, S;Xiong, B;Ding, J;Geng, MY;Huang, M;
    Year
    2019
    Journal
    Acta Pharmacol. Sin.
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.