Jagged 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

Jagged 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4386 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 402G/A,2526C/T,3417T/C not causing the amino acid variation.
Description
Full length Clone DNA of Homo sapiens collagen triple helix repeat containing 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI(two restriction sites) + NotI(6.54kb+2.41kb+1.99kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Jagged 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Jagged 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

Jagged 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

AGS cDNA ORF Clone, Human; AHD cDNA ORF Clone, Human; AWS cDNA ORF Clone, Human; CD339 cDNA ORF Clone, Human; HJ1 cDNA ORF Clone, Human; Jagged 1 cDNA ORF Clone, Human; JAGL1 cDNA ORF Clone, Human

Jagged 1 Background Information

Protein Jagged 1, also known as JAG1, JAGL1, and CD339, is a single-pass type I membrane protein that contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. JAG1/Jagged 1 seems to be involved in the early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly that consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left), and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.
Full Name
jagged 1
Research Areas
References
  • Oda T.et al., 1997, Nat. Genet. 16:235-242.
  • Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  • Li L. et al., 1998, Immunity. 8:43-55.
  • Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  • Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  • Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  • Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.