ITGA2B/CD41 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

ITGA2B/CD41 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3165 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1713G/A,3063C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+3.17kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ITGA2B/CD41 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITGA2B/CD41 cDNA ORF Clone, Human, C-His tag: Validated Images

ITGA2B/CD41 cDNA ORF Clone, Human, C-His tag: Synonyms

BDPLT16 cDNA ORF Clone, Human; BDPLT2 cDNA ORF Clone, Human; CD41 cDNA ORF Clone, Human; CD41B cDNA ORF Clone, Human; GP2B cDNA ORF Clone, Human; GPIIb cDNA ORF Clone, Human; GT cDNA ORF Clone, Human; GTA cDNA ORF Clone, Human; HPA3 cDNA ORF Clone, Human; PPP1R93 cDNA ORF Clone, Human

ITGA2B/CD41 Background Information

Full Name
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway

ITGA2B/CD41 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.