ITGA2B/CD41 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

ITGA2B/CD41 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3120 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

ITGA2B/CD41 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

BDPLT16 cDNA ORF Clone, Human; BDPLT2 cDNA ORF Clone, Human; CD41 cDNA ORF Clone, Human; CD41B cDNA ORF Clone, Human; GP2B cDNA ORF Clone, Human; GPIIb cDNA ORF Clone, Human; GT cDNA ORF Clone, Human; GTA cDNA ORF Clone, Human; HPA3 cDNA ORF Clone, Human; PPP1R93 cDNA ORF Clone, Human

ITGA2B/CD41 Background Information

Full Name
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway

ITGA2B/CD41 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.