ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3525 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1291C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human integrin, alpha 10 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI(6kb+3.53kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

ITGA10/Integrin alpha 10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Validated Images

ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

PRO827 cDNA ORF Clone, Human

ITGA10/Integrin alpha 10 Background Information

Full Name
integrin, alpha 10
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.