ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3504 bp
Description
Full length Clone DNA of Human integrin, alpha 10 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

ITGA10/Integrin alpha 10 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

PRO827 cDNA ORF Clone, Human

ITGA10/Integrin alpha 10 Background Information

Full Name
integrin, alpha 10
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.