Interferon alpha 10/IFNA10 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

Interferon alpha 10/IFNA10 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
570 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations: 66 G/A and 96 C/G, neither of which results in amino acid variation.
Description
Full length Clone DNA of Human interferon, alpha 10.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.57kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Interferon alpha 10/IFNA10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Interferon alpha 10/IFNA10 cDNA ORF Clone, Human, untagged: Validated Images

Interferon alpha 10/IFNA10 cDNA ORF Clone, Human, untagged: Synonyms

IFN-alphaC cDNA ORF Clone, Human; MGC119878 cDNA ORF Clone, Human; MGC119879 cDNA ORF Clone, Human

Interferon alpha 10/IFNA10 Background Information

Interferon alpha-10 (IFNA10) is a member of the interferon family. Interferons belong to the group of the regulatory glycoproteins, of low molecular mass. They are the products of infected cell-genome, but not virus, as a consequence of the cause answer by different inductors. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs have other functions: they activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes, and they increase the ability of uninfected host cells to resist new infection by the virus. Certain host symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Human IFNs are divided on the sequence of amino-acids into three groups: Alpha, Beta, and Gamma interferons.
Full Name
interferon, alpha 10
References
  • De Veer MJ, et al. (2001) Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol. 69 (6): 912-20.
  • Liu YJ. (2005) IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol. 23: 275-306.
  • Fensterl V, et al. (2009) Interferons and viral infections. Biofactors. 35 (1): 14-20.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.