Integrin alpha 3 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

Integrin alpha 3 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3201 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+3.2kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Integrin alpha 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin alpha 3 cDNA ORF Clone, Human, C-His tag: Validated Images

Integrin alpha 3 cDNA ORF Clone, Human, C-His tag: Synonyms

CD49C cDNA ORF Clone, Human; GAP-B3 cDNA ORF Clone, Human; GAPB3 cDNA ORF Clone, Human; ILNEB cDNA ORF Clone, Human; MSK18 cDNA ORF Clone, Human; VCA-2 cDNA ORF Clone, Human; VL3A cDNA ORF Clone, Human; VLA3a cDNA ORF Clone, Human

Integrin alpha 3 Background Information

Full Name
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • AKT Signaling Pathway
    AKT Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.