IL36RN/IL-1F5 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

IL36RN/IL-1F5 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Human interleukin 1 family, member 5 (delta), transcript variant 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL36RN/IL-1F5 cDNA ORF Clone, Human, N-Myc tag: Synonyms

FIL1 cDNA ORF Clone, Human; FIL1(DELTA) cDNA ORF Clone, Human; FIL1D cDNA ORF Clone, Human; IL-36Ra cDNA ORF Clone, Human; IL1F5 cDNA ORF Clone, Human; IL1HY1 cDNA ORF Clone, Human; IL1L1 cDNA ORF Clone, Human; IL1RP3 cDNA ORF Clone, Human; IL36RA cDNA ORF Clone, Human; IL36RN cDNA ORF Clone, Human; PSORP cDNA ORF Clone, Human; PSORS14 cDNA ORF Clone, Human

IL36RN/IL-1F5 Background Information

Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist, and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in the local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR-/- mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.
Full Name
interleukin 36 receptor antagonist
Related Pathways
  • IL1 signaling pathway
    IL1 signaling pathway
References
  • Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.
  • Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.
  • Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.