IL1F10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

IL1F10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Human interleukin 1 family, member 10 (theta), transcript variant 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

IL1F10 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

FIL1-theta cDNA ORF Clone, Human; FKSG75 cDNA ORF Clone, Human; IL-1HY2 cDNA ORF Clone, Human; IL-38 cDNA ORF Clone, Human; IL1-theta cDNA ORF Clone, Human; IL1HY2 cDNA ORF Clone, Human

IL1F10 Background Information

Full Name
interleukin 1 family, member 10 (theta)
Related Pathways
  • IL1 signaling pathway
    IL1 signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.