IL1F10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

IL1F10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens interleukin 1 family, member 10 (theta), transcript variant 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL1F10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

FIL1-theta cDNA ORF Clone, Human; FKSG75 cDNA ORF Clone, Human; IL-1HY2 cDNA ORF Clone, Human; IL-38 cDNA ORF Clone, Human; IL1-theta cDNA ORF Clone, Human; IL1HY2 cDNA ORF Clone, Human

IL1F10 Background Information

Full Name
interleukin 1 family, member 10 (theta)
Related Pathways
  • IL1 signaling pathway
    IL1 signaling pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.