IL-18 cDNA ORF Clone, Human, C-OFPSpark® tag

1/1
Price:
Size:
Number:

IL-18 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
561 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 18 (interferon-gamma-inducing factor) with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.25kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-18 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-18 cDNA ORF Clone, Human, C-OFPSpark® tag: Validated Images

IL-18 cDNA ORF Clone, Human, C-OFPSpark® tag: Synonyms

IGIF cDNA ORF Clone, Human; IL-18 cDNA ORF Clone, Human; IL-1g cDNA ORF Clone, Human; IL1F4 cDNA ORF Clone, Human; Interleukin 18 cDNA ORF Clone, Human

IL-18 Background Information

Interleukin-18 (IL-18, also known as interferon-gamma inducing factor) is a proinflammatory cytokine that belongs to the IL-1 superfamily and is produced by macrophages and other cells. This cytokine can induce the IFN-gamma production of T cells. The combination of IL-18 and IL12 has been shown to inhibit IL4 dependent IgE and IgG1 production, and enhance IgG2a production of B cells. IL-18 binding protein (IL18BP) can specifically interact with this cytokine, and thus negatively regulate its biological activity. IL-18 is an IL-1-like cytokine that requires cleavage with caspase-1 to become active, was found to increase IgE production in a CD4+ T cell -, IL-4- and STAT6-dependent fashion. IL-18 and T cell receptor-mediated stimulation could induce naive CD4+ T cells to develop into IL-4-producing cells in vitro. Thus, caspase-1 and IL-18 may be critical in the regulation of IgE production in vivo, providing a potential therapeutic target for allergic disorders. IL-18 production in primary synovial cultures and purified synovial fibroblasts was, in turn, upregulated by TNF-α and IL-1β, suggesting that monokine expression can feedback to promote Th1 cell development in the synovial membrane. Besides, synergistic combinations of IL-18, IL-12, and IL-15 may be of importance in sustaining both Th1 responses and monokine production in RA.
Full Name
interleukin 18
Research Areas
Related Pathways
  • IL1 signaling pathway
    IL1 signaling pathway
References
  • Dinarello CA. (1999) IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol. 103: 11-24.
  • Takeda K, et al.. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8(3): 383-90.
  • Gracie JA, et al.. (1999) A proinflammatory role for IL-18 in rheumatoid arthritis. J Clin Invest. 104(10): 1393-401.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.