IGSF3 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

IGSF3 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3645 bp
Description
Full length Clone DNA of Human immunoglobulin superfamily, member 3, transcript variant 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IGSF3 cDNA ORF Clone, Human, N-HA tag: Synonyms

EWI-3 cDNA ORF Clone, Human; LCDD cDNA ORF Clone, Human; V8 cDNA ORF Clone, Human

IGSF3 Background Information

Immunoglobulin superfamily member 3 (IGSF3), also known as Glu-Trp-Ile EWI motif-containing protein 3, IgSF3 and EWI-3 and IGSF3, is a single-pass type I membrane protein that belongs to the EWI subfamily of the Ig superfamily of molecules. IGSF3 has an overall structural similarity and strong sequence similarity to V7, a human leukocyte surface protein. IGSF3 contains eight Ig-like C2-type (immunoglobulin-like) domains. IGSF3 is expressed in a wide range of tissues with high expression in the placenta, kidney, and lung. EWI-2 is part of a novel Ig subfamily that includes EWI-F (F2alpha receptor regulatory protein (FPRP), CD9P-1 ), EWI-3 (IGSF3), and EWI-101 (CD101). All four members of this Ig subfamily contain a Glu-Trp-Ile (EWI) motif not seen in other Ig proteins. Human IGSF3 shares 92 % aa identity with mouse IGSF3.
Full Name
immunoglobulin superfamily, member 3
References
  • Saupe S, et al. (1998) Molecular cloning of a human cDNA IGSF3 encoding an immunoglobulin-like membrane protein: expression and mapping to chromosome band 1p13. Genomics. 52(3): 305-11.
  • Lazaar AL, et al. (2001) VCAM-1 activates phosphatidylinositol 3-kinase and induces p120Cbl phosphorylation in human airway smooth muscle cells. J Immunol. 166(1): 155-61.
  • Wetzel A, et al. (2004) Human Thy-1 (CD90) on activated endothelial cells is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18). J Immunol. 172(6): 3850-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.