IFN-omega cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

IFN-omega cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Human interferon, omega 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IFN-omega cDNA ORF Clone, Human, C-OFPSpark® tag: Synonyms

IFN-omega 1 cDNA ORF Clone, Human; IFNW1 cDNA ORF Clone, Human; interferon omega-1 cDNA ORF Clone, Human

IFN-omega Background Information

IFNs are a large family of proteins having antiviral, antiproliferative, and immunomodulatory effects, and are divided into two major classes, type I and type II, based on differences in receptor binding and nucleotide sequence. Type I IFNs consist of IFN α, β, τ, and ω and bind to the type I IFN receptor, whereas IFN-γ is the only type II IFN and is specific for the type II IFN receptor. Human IFN-ω, was identified by three independent groups in 1985 and is structurally related to IFN-α and -β. Both human IFN-ω and IFN-α are produced by virally induced leukocytes and have similar antiviral activities on human cell lines, and a sizeable proportion (at least 1%) of the total antiviral activity of leukocyte IFN is contributed by IFN-ωl. Also, it was reported that IFN-ω could inhibit the growth of human tumors in vivo.
Full Name
interferon, omega 1
References
  • Capon D.J., et al.,(1985), Two distinct families of human and bovine interferon-alpha genes are coordinately expressed and encode functional polypeptides. Mol. Cell. Biol. 5:768-779.
  • Adolf G.R., et al., (1991), Human interferon omega 1: isolation of the gene, expression in Chinese hamster ovary cells and characterization of the recombinant protein.Biochim. Biophys. Acta 1089:167-174.
  • Humphray S.J., et al.,(2004), DNA sequence and analysis of human chromosome 9.Nature 429:369-374.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.