IFN-omega Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

IFN-omega Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
588 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens interferon, omega 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IFN-omega Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

IFN-omega 1 cDNA ORF Clone, Human; IFNW1 cDNA ORF Clone, Human; interferon omega-1 cDNA ORF Clone, Human

IFN-omega Background Information

IFNs are a large family of proteins having antiviral, antiproliferative, and immunomodulatory effects, and are divided into two major classes, type I and type II, based on differences in receptor binding and nucleotide sequence. Type I IFNs consist of IFN α, β, τ, and ω and bind to the type I IFN receptor, whereas IFN-γ is the only type II IFN and is specific for the type II IFN receptor. Human IFN-ω, was identified by three independent groups in 1985 and is structurally related to IFN-α and -β. Both human IFN-ω and IFN-α are produced by virally induced leukocytes and have similar antiviral activities on human cell lines, and a sizeable proportion (at least 1%) of the total antiviral activity of leukocyte IFN is contributed by IFN-ωl. Also, it was reported that IFN-ω could inhibit the growth of human tumors in vivo.
Full Name
interferon, omega 1
References
  • Capon D.J., et al.,(1985), Two distinct families of human and bovine interferon-alpha genes are coordinately expressed and encode functional polypeptides. Mol. Cell. Biol. 5:768-779.
  • Adolf G.R., et al., (1991), Human interferon omega 1: isolation of the gene, expression in Chinese hamster ovary cells and characterization of the recombinant protein.Biochim. Biophys. Acta 1089:167-174.
  • Humphray S.J., et al.,(2004), DNA sequence and analysis of human chromosome 9.Nature 429:369-374.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.