HER3/ERBB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag
Cat: HG10201-ACGLN
HER3/ERBB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4758 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) , transcript variant 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI + NotI(6.54kb+4.76kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months
HER3/ERBB3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information
**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**
HER3/ERBB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images
HER3/ERBB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms
c-erbB-3 cDNA ORF Clone, Human; c-erbB3 cDNA ORF Clone, Human; EEBB3 cDNA ORF Clone, Human; ErbB-3 cDNA ORF Clone, Human; erbB3-S cDNA ORF Clone, Human; HER3 cDNA ORF Clone, Human; LCCS2 cDNA ORF Clone, Human; MDA-BF-1 cDNA ORF Clone, Human; p180-ErbB3 cDNA ORF Clone, Human; p45-sErbB3 cDNA ORF Clone, Human; p85-sErbB3 cDNA ORF Clone, Human
HER3/ERBB3 Background Information
ErbB3, also known as Her3(human epidermal growth factor receptor3), is a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound glycoprotein has a neuregulin binding domain but has not an active kinase domain., and therefore can not mediate the intracellular signal transduction through protein phosphorylation. However, its heterodimer with ErbB2 or other EGFR members responsible for tyrosine phosphorylation forms a receptor complex with high affinity, and initiates the related pathway which lead to cell proliferation or differentiation. ErbB3 has been shown to implicated in numerous cancers, including prostate, bladder, and breast tumors. This protein has different isoforms derived from alternative splicing variants, and among which, the secreted isoform lacking the intermembrane region modulates the activity of membrane-bound form.
Full Name
erb-b2 receptor tyrosine kinase 3
Research Areas
References
- Kraus M.H., et al.,(1989), Isolation and characterization of ERBB3, a third member of the ERBB/epidermal growth factor receptor family: evidence for overexpression in a subset of human mammary tumors. Proc. Natl. Acad. Sci. U.S.A. 86:9193-9197.
- Plowman G.D., et al., (1990), Molecular cloning and expression of an additional epidermal growth factor receptor-related gene.Proc. Natl. Acad. Sci. U.S.A. 87:4905-4909.
- Katoh M., et al.,(1993), c-erbB3 gene encodes secreted as well as transmembrane receptor tyrosine kinase.Biochem. Biophys. Res. Commun. 192:1189-1197.
HER3/ERBB3 cDNA ORF Clone, Human, Related Products
HER3/ERBB3 cDNA ORF Clone, Rat, Related Products
HER3/ERBB3 cDNA ORF Clone, Rabbit, Related Products
