GFAP cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

GFAP cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Description
Full length Clone DNA of Human glial fibrillary acidic protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GFAP cDNA ORF Clone, Human, N-HA tag: Synonyms

ALXDRD cDNA ORF Clone, Human

GFAP Background Information

GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.
Full Name
glial fibrillary acidic protein
Research Areas
References
  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.