FCRL2 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

FCRL2 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1527 bp
Description
Full length Clone DNA of Human Fc receptor-like 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FCRL2 cDNA ORF Clone, Human, N-HA tag: Synonyms

CD307b cDNA ORF Clone, Human; FCRH2 cDNA ORF Clone, Human; FCRL2 cDNA ORF Clone, Human; IFGP4 cDNA ORF Clone, Human; IRTA4 cDNA ORF Clone, Human; SPAP1 cDNA ORF Clone, Human; SPAP1A cDNA ORF Clone, Human; SPAP1B cDNA ORF Clone, Human; SPAP1C cDNA ORF Clone, Human

FCRL2 Background Information

Fc receptor-like 2 (FCRL2) is highly expressed on B-cell chronic lymphocytic leukemia (B-CLL) cells and could possibly influence disease pathogenesis. FCRL2 has robust predictive value for determining IGHV gene mutation status and clinical progression and thus may further improve prognostic definition in CLL (B-cell chronic lymphocytic leukemia).
Full Name
Fc receptor like 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.