FCRL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

FCRL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
768 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens Fc receptor-like 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

FCRL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

CD307b cDNA ORF Clone, Human; FCRH2 cDNA ORF Clone, Human; FCRL2 cDNA ORF Clone, Human; IFGP4 cDNA ORF Clone, Human; IRTA4 cDNA ORF Clone, Human; SPAP1 cDNA ORF Clone, Human; SPAP1A cDNA ORF Clone, Human; SPAP1B cDNA ORF Clone, Human; SPAP1C cDNA ORF Clone, Human

FCRL2 Background Information

Fc receptor-like 2 (FCRL2) is highly expressed on B-cell chronic lymphocytic leukemia (B-CLL) cells and could possibly influence disease pathogenesis. FCRL2 has robust predictive value for determining IGHV gene mutation status and clinical progression and thus may further improve prognostic definition in CLL (B-cell chronic lymphocytic leukemia).
Full Name
Fc receptor like 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.