EVI2A cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

EVI2A cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Human ecotropic viral integration site 2A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Citation List

EVI2A cDNA ORF Clone, Human, C-HA tag: Synonyms

EVDA cDNA ORF Clone, Human; EVI-2A cDNA ORF Clone, Human; EVI2 cDNA ORF Clone, Human

EVI2A Background Information

Full Name
ecotropic viral integration site 2A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.