EphB2 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

EphB2 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2964 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1410 G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human EPH receptor B2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6kb + 3kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

EphB2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphB2 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

EphB2 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms

CAPB cDNA ORF Clone, Human; DRT cDNA ORF Clone, Human; EK5 cDNA ORF Clone, Human; EPHT3 cDNA ORF Clone, Human; ERK cDNA ORF Clone, Human; Hek5 cDNA ORF Clone, Human; PCBC cDNA ORF Clone, Human; Tyro5 cDNA ORF Clone, Human

EphB2 Background Information

Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine formation. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induces various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.
Full Name
EPH receptor B2
Related Pathways
  • Actin Dynamics Signaling Pathway
    Actin Dynamics Signaling Pathway
  • G Protein-coupled Receptors Signaling
    G Protein-coupled Receptors Signaling
  • MAPK-Erk Pathway
    MAPK-Erk Pathway
  • Autophagy Pathway
    Autophagy Pathway
References
  • Zisch AH, et al. (1998) Complex formation between EphB2 and Src requires phosphorylation of tyrosine 611 in the EphB2 juxtamembrane region. Oncogene. 16 (20): 2657-70.
  • Yu HH, et al. (2001) Multiple signaling interactions of Abl and Arg kinases with the EphB2 receptor. Oncogene. 20 (30): 3995-4006.
  • Zisch AH, et al. (2000) Replacing two conserved tyrosines of the EphB2 receptor with glutamic acid prevents binding of SH2 domains without abrogating kinase activity and biological responses. Oncogene. 19 (2): 177-87.
  • Role of SHIP2 in cell repulsion regulated by Eph receptor and ephrin signaling
    Author
    Ashlin, TG;Wu, Z;Xu, Q;Wilkinson, DG;
    Year
    2019
    Journal
    BioRxiv
    Application
    transfection
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.