EpCAM cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag
Cat: HG10694-NF
EpCAM cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
945 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor-associated calcium signal transducer 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.96kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.
EpCAM cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information
**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**
EpCAM cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Validated Images
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
EpCAM cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag: Synonyms
DIAR5 cDNA ORF Clone, Human; EGP-2 cDNA ORF Clone, Human; EGP314 cDNA ORF Clone, Human; EGP40 cDNA ORF Clone, Human; ESA cDNA ORF Clone, Human; HNPCC8 cDNA ORF Clone, Human; KS1/4 cDNA ORF Clone, Human; KSA cDNA ORF Clone, Human; M4S1 cDNA ORF Clone, Human; MIC18 cDNA ORF Clone, Human; MK-1 cDNA ORF Clone, Human; TACSTD1 cDNA ORF Clone, Human; TROP-1 cDNA ORF Clone, Human; TROP1 cDNA ORF Clone, Human
EpCAM Background Information
Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â…transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.
Full Name
epithelial cell adhesion molecule
References
- Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
- Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
- Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
- Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.
EpCAM cDNA ORF Clone, Human, Related Products
EpCAM cDNA ORF Clone, Mouse, Related Products
EpCAM cDNA ORF Clone, Rat, Related Products
EpCAM cDNA ORF Clone, Rhesus, Related Products
If you couldn't find the specific citation, you can:
