EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Description
Full length Clone DNA of Human ectodysplasin A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged: Synonyms

ECTD1 cDNA ORF Clone, Human; ED1 cDNA ORF Clone, Human; ED1-A1 cDNA ORF Clone, Human; ED1-A2 cDNA ORF Clone, Human; EDA-A1 cDNA ORF Clone, Human; EDA-A2 cDNA ORF Clone, Human; EDA1 cDNA ORF Clone, Human; EDA2 cDNA ORF Clone, Human; HED cDNA ORF Clone, Human; HED1 cDNA ORF Clone, Human; ODT1 cDNA ORF Clone, Human; STHAGX1 cDNA ORF Clone, Human; XHED cDNA ORF Clone, Human; XLHED cDNA ORF Clone, Human

EDA-A1/Ectodysplasin-A1 Background Information

Full Name
ectodysplasin A

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.