EDA-A1/Ectodysplasin-A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

EDA-A1/Ectodysplasin-A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens ectodysplasin A.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

EDA-A1/Ectodysplasin-A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

ECTD1 cDNA ORF Clone, Human; ED1 cDNA ORF Clone, Human; ED1-A1 cDNA ORF Clone, Human; ED1-A2 cDNA ORF Clone, Human; EDA-A1 cDNA ORF Clone, Human; EDA-A2 cDNA ORF Clone, Human; EDA1 cDNA ORF Clone, Human; EDA2 cDNA ORF Clone, Human; HED cDNA ORF Clone, Human; HED1 cDNA ORF Clone, Human; ODT1 cDNA ORF Clone, Human; STHAGX1 cDNA ORF Clone, Human; XHED cDNA ORF Clone, Human; XLHED cDNA ORF Clone, Human

EDA-A1/Ectodysplasin-A1 Background Information

Full Name
ectodysplasin A

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.