EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ectodysplasin A (EDA), transcript variant 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.18kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EDA-A1/Ectodysplasin-A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged: Validated Images

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged: Synonyms

ECTD1 cDNA ORF Clone, Human; ED1 cDNA ORF Clone, Human; ED1-A1 cDNA ORF Clone, Human; ED1-A2 cDNA ORF Clone, Human; EDA-A1 cDNA ORF Clone, Human; EDA-A2 cDNA ORF Clone, Human; EDA1 cDNA ORF Clone, Human; EDA2 cDNA ORF Clone, Human; HED cDNA ORF Clone, Human; HED1 cDNA ORF Clone, Human; ODT1 cDNA ORF Clone, Human; STHAGX1 cDNA ORF Clone, Human; XHED cDNA ORF Clone, Human; XLHED cDNA ORF Clone, Human

EDA-A1/Ectodysplasin-A1 Background Information

Full Name
ectodysplasin A

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.