DR4/TRAIL R1 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

DR4/TRAIL R1 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DR4/TRAIL R1 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

APO2 cDNA ORF Clone, Human; CD261 cDNA ORF Clone, Human; DR4 cDNA ORF Clone, Human; MGC9365 cDNA ORF Clone, Human; TNFRSF10A cDNA ORF Clone, Human; TRAILR-1 cDNA ORF Clone, Human; TRAILR1 cDNA ORF Clone, Human

DR4/TRAIL R1 Background Information

Tumor necrosis factor receptor superfamily, member 1a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL R1) or CD261 antigen, is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF1/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R1/CD261/TNFRSF1A serves as a receptor for the cytotoxic ligand TNFSF1/TRAIL. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. TRAIL R1 can promote the activation of NF-kappa-B. TRAIL R1/CD261/TNFRSF1A induces apoptosis of many transformed cell lines but not of normal tissues, even though its death domain-containing receptor, DR4, is expressed on both cell types.
Full Name
tumor necrosis factor receptor superfamily member 10a
References
  • Kimberley FC, et al. (2005) Following a TRAIL: update on a ligand and its five receptors.". Cell Res. 14 (5): 359–72.
  • Schneider P, et al. (1997) Characterization of two receptors for TRAIL.". FEBS Lett. 416 (3): 329–34.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait