DDR1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

DDR1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2742 bp
Description
Full length Clone DNA of Human discoidin domain receptor tyrosine kinase 1 , transcript variant 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Citation List

DDR1 cDNA ORF Clone, Human, untagged: Synonyms

CAK cDNA ORF Clone, Human; CD167 cDNA ORF Clone, Human; DDR cDNA ORF Clone, Human; EDDR1 cDNA ORF Clone, Human; HGK2 cDNA ORF Clone, Human; MCK10 cDNA ORF Clone, Human; NEP cDNA ORF Clone, Human; NTRK4 cDNA ORF Clone, Human; PTK3 cDNA ORF Clone, Human; PTK3A cDNA ORF Clone, Human; RTK6 cDNA ORF Clone, Human; TRKE cDNA ORF Clone, Human

DDR1 Background Information

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 1 (MCK1), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK1/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK1/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.
Full Name
discoidin domain receptor tyrosine kinase 1
Related Pathways
  • p53 Pathway
    p53 Pathway
References
  • Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.
  • Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.
  • Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.

DDR1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.