CTLA-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

CTLA-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1401 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens cytotoxic T-lymphocyte-associated protein 4, transcript variant 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(6.54kb+1.4kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CTLA-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CTLA-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

CTLA-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

ALPS5 cDNA ORF Clone, Human; CD cDNA ORF Clone, Human; CD152 cDNA ORF Clone, Human; CELIAC3 cDNA ORF Clone, Human; CTLA-4 cDNA ORF Clone, Human; GRD4 cDNA ORF Clone, Human; GSE cDNA ORF Clone, Human; IDDM12 cDNA ORF Clone, Human

CTLA-4 Background Information

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD8 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).
Full Name
cytotoxic T-lymphocyte-associated protein 4
References
  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.

CTLA-4 cDNA ORF Clone, Rat, Related Products

CTLA-4 cDNA ORF Clone, Canine, Related Products

  • Engineering Programmed Death Ligand-1/Cytotoxic T-Lymphocyte-Associated Antigen-4 Dual-Targeting Nanovesicles for Immunosuppressive Therapy in Transplantation
    Author
    Xu, Z;Tsai, HI;Xiao, Y;Wu, Y;Su, D;Yang, M;Zha, H;Yan, F;Liu, X;Cheng, F;Chen, H;
    Year
    2020
    Journal
    ACS Nano
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.