COMP cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

COMP cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2316 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cartilage oligomeric matrix protein with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+2.32kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

COMP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMP cDNA ORF Clone, Human, C-HA tag: Validated Images

COMP cDNA ORF Clone, Human, C-HA tag: Synonyms

EDM1 cDNA ORF Clone, Human; EPD1 cDNA ORF Clone, Human; MED cDNA ORF Clone, Human; PSACH cDNA ORF Clone, Human; THBS5 cDNA ORF Clone, Human

COMP Background Information

Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and belongs to the subgroup B of the thrombospondin protein family. This protein is expressed primarily in cartilage, ligament, and tendon, and binds to other ECM proteins such as collagen I, II and IX with high affinities depending on the divalent cations Zn2+ or Ni2+. COMP is a secreted glycoprotein that is important for growth plate organization and function. It is suggested to play a role in cell growth and development, and recent studies have revealed the possible mechanism that it protects cells against death by elevating members of the IAP (inhibitor of apoptosis protein) family of survival proteins. Mutations in COMP cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (EDM1), and up-regulated expression of COMP are observed in rheumatoid arthritis and certain carcinomas.
Full Name
cartilage oligomeric matrix protein
References
  • Posey KL, et al. (2004) Role of TSP-5/COMP in pseudoachondroplasia. Int J Biochem Cell Biol. 36(6): 1005-12.
  • Chen FH, et al. (2005) Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. J Biol Chem. 282(34): 24591-8.
  • Posey KL, et al. (2008) The role of cartilage oligomeric matrix protein (COMP) in skeletal disease. Curr Drug Targets. 9(10): 869-77.
  • Tan K, et al. (2009) The crystal structure of the signature domain of cartilage oligomeric matrix protein: implications for collagen, glycosaminoglycan and integrin binding. FASEB J. 23(8): 2490-501.
  • A variant in SMOC2, inhibiting BMP signaling by competitively binding to BMPR1B, causes multiple epiphyseal dysplasia
    Author
    Long, F;Li, L;Shi, H;Li, P;Guo, S;Ma, Y;Li, Y;Wei, S;
    Year
    2020
    Journal
    BioRxiv
    Application
    transfection
  • A SMOC2 variant inhibits BMP signaling by competitively binding to BMPR1B and causes growth plate defects
    Author
    Long, F;Shi, H;Li, P;Guo, S;Ma, Y;Wei, S;Li, Y;Gao, F;Gao, S;Wang, M;Duan, R;Wang, X;Yang, K;Sun, W;Li, X;Li, J;Liu, Q;
    Year
    2020
    Journal
    Bone
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.