Claudin18 cDNA ORF Clone, Human, C-Myc tag

1/1
Price:
Size:
Number:

Claudin18 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
831 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human claudin 18 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.83kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Claudin18 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About Claudin18

Entrez Gene ID

Claudin18 cDNA ORF Clone, Human, C-Myc tag: Validated Images

Claudin18 cDNA ORF Clone, Human, C-Myc tag: Synonyms

SFTA5 cDNA ORF Clone, Human; SFTPJ cDNA ORF Clone, Human

Claudin18 Background Information

Full Name
claudin 18
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.