cIAP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

cIAP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI(6kb+1.9kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

cIAP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

cIAP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

cIAP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

API1 cDNA ORF Clone, Human; c-IAP1 cDNA ORF Clone, Human; cIAP1 cDNA ORF Clone, Human; Hiap-2 cDNA ORF Clone, Human; HIAP2 cDNA ORF Clone, Human; MIHB cDNA ORF Clone, Human; RNF48 cDNA ORF Clone, Human

cIAP1 Background Information

The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteins are (IAP) whose members are characterized by a novel domain of about 70 amino acids termed baculoviral IAP repeats (BIRs). The BIR domains of cIAP1 and cIAP2 bind to caspases, the key effector proteases of apoptosis. The IAP protein family which can enhance cell survival are crucial regulators of programmed cell death. Both cIAP1 and cIAP2 are the E3 ubiquitin protein isopeptide ligases for Smac, taking part in promoting cancer survival through functioning as E3 ubiquitin ligases. Removal of cIAP1 by genetic deletion may result in NF-κB signaling activation that induces TNFα production and in killing sensitive tumor cells through enhanced TNF-R1 death-receptor signaling and caspase 8 activation. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. cIAP1 and cIAP2 are also reported to be regulators of NF-kB activation upon TNFαtreatment.
Full Name
baculoviral IAP repeat containing 2
Related Pathways
  • Death Receptor Signaling
    Death Receptor Signaling
  • TNF Signaling
    TNF Signaling
References
  • Vince JE, et al. (2007) IAP Antagonists Target cIAP1 to Induce TNF-Dependent Apoptosis. Cell. 131(4): 682-93.
  • Hu SM, et al. et al. (2003) Cellular Inhibitor of Apoptosis 1 and 2 Are Ubiquitin Ligases for the Apoptosis Inducer Smac/DIABLO. The Journal of Biological Chemistry. 278: 10055-60.
  • Imoto I, et al. (2011) Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas 1. Cancer Res. 61: 6629.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.