CD52 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

CD52 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
915 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens CD52 molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(6.54kb+0.92kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD52 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD52 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

CD52 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

CDW52 cDNA ORF Clone, Human

CD52 Background Information

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.
Full Name
CD52 molecule
References
  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.