CD34 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

CD34 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1203 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD34 molecule, transcript variant 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.20kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD34 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD34 cDNA ORF Clone, Human, C-His tag: Validated Images

CD34 Background Information

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.
Full Name
CD34 molecule
References
  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.