CD22 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

CD22 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2028 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD22 molecule.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 2.03kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD22 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD22 cDNA ORF Clone, Human, untagged: Synonyms

SIGLEC-2 cDNA ORF Clone, Human; SIGLEC2 cDNA ORF Clone, Human

CD22 Background Information

CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed in the cytoplasm of pro-B and pre-B cells, and on the surface as B cells mature to become IgD+. CD22 serves as an adhesion receptor for sialic acid-bearing ligands expressed on erythrocytes and all leukocyte classes. In addition to its potential role as a mediator of intercellular interactions, signal transduction through CD22 can activate B cells and modulate antigen receptor signaling in vitro. The phenotype of CD22-deficient mice suggests that CD22 is primarily involved in the generation of mature B cells within the bone marrow, blood, and marginal zones of lymphoid tissues. CD22 recruits the tyrosine phosphatase Src homology 2 domain-containing phosphatase 1 (SHP-1) to immunoreceptor tyrosine-based inhibitory motifs (ITIMs) and inhibits B-cell receptor (BCR)-induced Ca2+ signaling on normal B cells. CD22 interacts specifically with ligands carrying alpha2-6-linked sialic acids. As an inhibitory coreceptor of the B-cell receptor (BCR), CD22 plays a critical role in establishing signalling thresholds for B-cell activation. Like other coreceptors, the ability of CD22 to modulate B-cell signalling is critically dependent upon its proximity to the BCR, and this in turn is governed by the binding of its extracellular domain to alpha2,6-linked sialic acid ligands. However, genetic studies in mice reveal that some CD22 functions are regulated by ligand binding, whereas other functions are ligand-independent and may only require expression of an intact CD22 cytoplasmic domain at the B-cell surface. CD19 regulates CD22 phosphorylation by augmenting Lyn kinase activity, while CD22 inhibits CD19 phosphorylation via SHP-1.
Full Name
CD22 molecule
Related Pathways
  • B Cell Receptor Signaling Pathway
    B Cell Receptor Signaling Pathway
References
  • Tedder TF, et al. (1997) CD22, a B lymphocyte-specific adhesion molecule that regulates antigen receptor signaling. Annu Rev Immunol. 15: 481-504.
  • Tedder TF, et al. (2005) CD22: a multifunctional receptor that regulates B lymphocyte survival and signal transduction. Adv Immunol. 88: 1-50.
  • Fujimoto M, et al. (2007) B cell signaling and autoimmune diseases: CD19/CD22 loop as a B cell signaling device to regulate the balance of autoimmunity. J Dermatol Sci. 46(1): 1-9.
  • Walker JA, et al. (2008) CD22: an inhibitory enigma. Immunology. 123(3): 314-25.
  • Nitschke L. (2009) CD22 and Siglec-G: B-cell inhibitory receptors with distinct functions. Immunol Rev. 230(1): 128-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.