CD160 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

CD160 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
546 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens CD160 molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD160 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

BY55 cDNA ORF Clone, Human; NK1 cDNA ORF Clone, Human; NK28 cDNA ORF Clone, Human

CD160 Background Information

CD16 antigen, also known as Natural killer cell receptor BY55 and CD16, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD16 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD16 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD16 is expressed in spleen, peripheral blood, and small intestine. Expression of CD16 is restricted to functional NK and T cytotoxic lymphocytes. CD16 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD16+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD16+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD16 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.
Full Name
CD160 molecule
Research Areas
References
  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.