C1QL1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

C1QL1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Human complement component 1, q subcomponent-like 1
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About C1QL1

Entrez Gene ID

C1QL1 cDNA ORF Clone, Human, untagged: Synonyms

C1QRF cDNA ORF Clone, Human; C1QTNF14 cDNA ORF Clone, Human; CRF cDNA ORF Clone, Human

C1QL1 Background Information

Full Name
complement component 1, q subcomponent-like 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.