c-Myc/MYC cDNA ORF Clone, Human, C-Myc tag

1/1
Price:
Size:
Number:

c-Myc/MYC cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1410 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-myc myelocytomatosis viral oncogene homolog (avian) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.41kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

c-Myc/MYC cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

c-Myc/MYC cDNA ORF Clone, Human, C-Myc tag: Validated Images

c-Myc/MYC cDNA ORF Clone, Human, C-Myc tag: Synonyms

bHLHe39 cDNA ORF Clone, Human; c-Myc cDNA ORF Clone, Human; MRTL cDNA ORF Clone, Human; MYCC cDNA ORF Clone, Human

c-Myc/MYC Background Information

MYC (MYC Proto-Oncogene, BHLH Transcription Factor) is a Protein Coding gene. This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis, and cellular transformation. MYC largely functions as a transcription factor that promotes the expression of numerous target genes to coordinate death, proliferation, and metabolism at the cellular, tissue, and organismal levels. MYC is one of the most important oncogenes in cancer. MYC overexpression can be achieved through a variety of mechanisms, including gene duplications, chromosomal translocations, or somatic mutations leading to increased MYC stability. It is widely expressed in the gall bladder, esophagus, and other tissues. Diseases associated with MYC include Burkitt Lymphoma and High-Grade B-Cell Lymphoma With Myc And/ Or Bcl2 And/Or Bcl6 Rearrangement.
Full Name
v-myc avian myelocytomatosis viral oncogene homolog
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
References
  • Ding X, et al., 2009, PLoS One. 4(6): e5949.
  • Ratsima H, et al., 2011, Proc Natl Acad Sci. 108(43): E914-23.
  • Chiang YJ, et al., 2013, PLoS One. 8(4): e61761.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.