BRG1 cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

BRG1 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4986 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
Restriction Sites
KpnI(three restriction sites) + XbaI(6kb+0.19kb+1.42kb+3.38kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BRG1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About BRG1

Entrez Gene ID

BRG1 cDNA ORF Clone, Human, C-HA tag: Validated Images

BRG1 cDNA ORF Clone, Human, C-HA tag: Synonyms

BAF190 cDNA ORF Clone, Human; BAF190A cDNA ORF Clone, Human; BRG1 cDNA ORF Clone, Human; hSNF2b cDNA ORF Clone, Human; MRD16 cDNA ORF Clone, Human; RTPS2 cDNA ORF Clone, Human; SNF2 cDNA ORF Clone, Human; SNF2L4 cDNA ORF Clone, Human; SNF2LB cDNA ORF Clone, Human; SWI2 cDNA ORF Clone, Human

BRG1 Background Information

The gene encoding the ATPase of the chromatin remodeling SWI/SNF complexes SMARCA4 (BRG1) is often mutated or silenced in tumors, suggesting a role as tumor suppressor. A high expression of SMARCA4 is associated with aggressive tumors, a high expression of SMARCA2 is associated with benign differentiated tumors, suggesting that SMARCA4 and SMARCA2 play opposite roles in cancer. Mutation of SMARCA4 (BRG1), the ATPase of BAF (mSWI/SNF) and PBAF complexes, contributes to a range of malignancies and neurologic disorders. The absence of SMARCA4/BRG1 immunostaining proved very useful in the diagnosis of hypercalcemic small cell ovarian carcinoma.
Full Name
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Research Areas

BRG1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.