B7-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

B7-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Homo sapiens CD80 molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + NotI(6.54kb+1.60kb)
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

B7-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B7-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

B7-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

B7 cDNA ORF Clone, Human; B7-1 cDNA ORF Clone, Human; B7.1 cDNA ORF Clone, Human; BB1 cDNA ORF Clone, Human; CD28LG cDNA ORF Clone, Human; CD28LG1 cDNA ORF Clone, Human; LAB7 cDNA ORF Clone, Human

B7-1 Background Information

The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.
Full Name
CD80 molecule
Research Areas
References
  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • Engineering Programmed Death Ligand-1/Cytotoxic T-Lymphocyte-Associated Antigen-4 Dual-Targeting Nanovesicles for Immunosuppressive Therapy in Transplantation
    Author
    Xu, Z;Tsai, HI;Xiao, Y;Wu, Y;Su, D;Yang, M;Zha, H;Yan, F;Liu, X;Cheng, F;Chen, H;
    Year
    2020
    Journal
    ACS Nano
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.