Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens angiopoietin 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Synonyms

AGP1 cDNA ORF Clone, Human; AGPT cDNA ORF Clone, Human; ANG1 cDNA ORF Clone, Human

Angiopoietin-1 Background Information

The angiopoietin (ANGPT)-TIE2/TEK signaling pathway is essential for blood and lymphatic vascular homeostasis. ANGPT1 is a potent TIE2 activator, whereas ANGPT2 functions as a context-dependent agonist/antagonist. In disease, ANGPT2-mediated inhibition of TIE2 in blood vessels is linked to vascular leak, inflammation, and metastasis. Primary congenital glaucoma (PCG) is a leading cause of blindness in children worldwide and is caused by developmental defects in 2 aqueous humor outflow structures, Schlemm's canal (SC) and the trabecular meshwork. We previously identified loss-of-function mutations in the angiopoietin (ANGPT) receptor TEK in families with PCG and showed that ANGPT/TEK signaling is essential for SC development. A role for the major ANGPT ligands in the development of the aqueous outflow pathway. We determined that ANGPT1 is essential for SC development, and that Angpt1-knockout mice form a severely hypomorphic canal with elevated intraocular pressure. By linking ANGPT1 with PCG, these results highlight the importance of ANGPT/TEK signaling in glaucoma pathogenesis and identify a candidate target for therapeutic development.
Full Name
angiopoietin 1
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.