AAMDC cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

AAMDC cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
369 bp
Description
Full length Clone DNA of Human adipogenesis associated, Mth938 domain containing with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AAMDC cDNA ORF Clone, Human, N-His tag: Synonyms

C11orf67 cDNA ORF Clone, Human; CK067 cDNA ORF Clone, Human; PTD015 cDNA ORF Clone, Human

AAMDC Background Information

Full Name
adipogenesis associated, Mth938 domain containing
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.