Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

Price:
Size:
Number:

Hepatitis C virus (HCV-1a) NS5B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged: General Information

Gene
Species
HCV
NCBI Ref Seq
RefSeq ORF Size
1773 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence NC_004102.1 (7602..9374), corresponding to amino acid sequence NP_751928.1.
Description
Full length Clone DNA of Hepatitis C virus (HCV) (serotype 1a, isolate H77) NS5B with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait