Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized), C-GFPSpark tag

1/1
Price:
Size:
Number:

Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized), C-GFPSpark tag: General Information

Gene
Species
EBOV
RefSeq ORF Size
2310 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACI28624.1.
Description
Full length Clone DNA of Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+2.31kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Ebola virus Glycoprotein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein Gene ORF cDNA clone expression plasmid (Codon Optimized), C-GFPSpark tag: Validated Images

Ebola virus Glycoprotein Background Information

The fourth gene of the EBOV genome encodes a 16-kDa envelope-attached glycoprotein (GP) and a 11 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.
References
  • Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
  • Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
  • Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
  • Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
  • Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.

Ebola virus Glycoprotein cDNA ORF Clone, EBOV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.