Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

1/1
Price:
Size:
Number:

Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag: General Information

Gene
Species
EBOV
RefSeq ORF Size
1485 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with KJ660346.1 (nt 10345-11100).
Description
Full length Clone DNA of Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) membrane-associated protein VP24 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+1.49kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Ebola virus VP24 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag: Validated Images

Citation List

Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag: Synonyms

VP24 cDNA ORF Clone, EBOV

Ebola virus VP24 cDNA ORF Clone, EBOV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.