Clusterin cDNA ORF Clone, Cynomolgus, N-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

Clusterin cDNA ORF Clone, Cynomolgus, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Description
Full length Clone DNA of Cynomolgus clusterin with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

Clusterin Background Information

Clusterin, also known as complement-associated protein SP-4, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.
Full Name
clusterin
References
  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.