pCMV3-untagged Negative Control Vector

  • Negative control for the pCMV3-untagged clone.
  • Vector sequence is the same as pCMV3-untagged, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV3-untagged-NCV (Negative Control Vector) Physical Map
Vector Sequence
 Vector Name pCMV3-untagged-NCV
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Protein Tag None
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV3-untagged-NCV (Negative Control Vector) Multiple Cloning Sites

  • Epidermal growth factor promotes proliferation of dermal papilla cells via Notch signaling pathway
    Zhang, H;Nan, W;Wang, S;Zhang, T;Si, H;Wang, D;Yang, F;Li, G;
  • Basic fibroblast growth factor promotes doxorubicin resistance in chondrosarcoma cells by affecting XRCC5 expression
    Hsieh, MJ;Huang, C;Lin, CC;Tang, CH;Lin, CY;Lee, IN;Huang, HC;Chen, JC;
    Mol. Carcinog.
  • Human Organic Anion Transporting Polypeptide 1B3 Applied as an MRI-Based Reporter Gene
    Baek, S;Ul-Haq, A;Kim, D;Choi, H;Kim, M;Choi, H;Kim, H;
    Korean J Radiol
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.